PathoYeastract
C.albicans
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name CR_09210W_B
Allele CR_09210W_A
Strain SC5314
Description Verified ORF; (orf19.7319) Zinc-finger transcription factor; regulates alpha-glucosidase exression; complements S. cerevisiae suc2 for sucrose utilization and mal13 maltase defect; required for yeast cell adherence to silicone substrate; rat catheter biofilm induced
External source Open in CGD external link
Gene Sequence
Download FASTA
Hide Seq
>CR_09210W_B CR_09210W_B
ATGTCCAAAGGTAAAAGAGCACCTTATACACGGCCCTGCGATTCTTGCAGTTTTCGAAAA
GTCAAGTGTGATATGAAAACCCCATGTTCCAGATGTGTCCTTAATAACTTGAAATGTACG
AATAATCGAATACGAAAAAAATGTGGTCCTAAGAAGATCCGTGATAGAACTCGAGAAGCA
ATTAATAATCTAAGTAATAAAGAAGATCCCAAAACAAATTCATTTATCCCGCATTTCCAG
TTGGACAAGTTACAGCCCTGTTTGGAGACATATCAAACTTGGTATTATGGAATTTGGCCG
GTCTTGTCGATCTCAGATTTGAATATGAAAATTACTAAACGAGATGTGTCAGCTTATGCA
CTTGCCTGTGCATTAAGTGCAGCAATACTCAATCAAATAGATTTTATTAGTAACAATGGG
ACCTATTGTATCCCCGAAGACGTTAAGAAATTGGACTTTATTGGTGAATGTATTCGAGCT
CGCACGTTTATGAATTATCAAATGACTCCCACCCTTGAGACAATATTGACATCATTTTTT
TTACATGTGGCTGAAGTGAATAAAGGTAGCAAACCAGCGGCAATTATTTATTTGAGAGAA
GCTATCACAATGGCTCAGATAATTGGACTACATAATGAATCGACATATAAGCTGAAACCA
GTTGCTGAAGCACATCGAATGAGAAAAATATATTTTATGTTAATGGTCACAGAAAGGTTT
ATGTGTATTGACGATTTGATCCCTGTTGTTCTTGAAAACTCGATCAAAGAGTTTTCGTTG
GATGATGAACAATATTCAGTATTAATTGATGGATTCAAAGAGTTGGTCAAGGTTTTCTCC
ATCCCTCTGAAAGCCATTTTCGACAGATTTATACAAATGAATGATTCAATATCCATGCCT
CCAGAGACCGCTGGGTTACTCAACAAAATACAACTAGAACTAGAGTCTATTTGTATATCA
CCAGTGGCACCAGATATCCAAAAGGCAAATATAATAGTTAGTAAATATTGGATGAAGGCG
TTGACTTGGAAAATTACACGAAAAAACAACTTATTAGATGACTTTGTGACTACATTATGT
GTCAAATATCCAATAGAGTTATCTGAACAATTTCTTGGAGAAATCAAGAGTATACCTTTG
AGAGCATTTGAATCAAATGGACCTGGGGTGGTATTCAAGTTATTGCTGATAGCAACTGTC
TTAATTGACTCAATTAATTTAAGCAATGATGTCTCAGGTTATGAATCATTACAGCGCATG
TTTGATTTGATTTCGAAATTGAAAAAGACAGATATGATCATTCCACGACGAGAATATGAT
AGAATAAAAGAAGCATTAACTAAAATGGAAATAGATATTTTCTTCAGCAGTGCCCAACTG
GGCGGCTACATTTCCGAAGTGGAATCAAATGGCTCATTGGACGCCTTTCTTACTGATCCG
CTTGTATTTTATTCAGGAAGCAATGATAATCCTACTCCCAGTTACATACCAGATTATCAA
AAATAA
Promoter Sequence
Download FASTA
>CR_09210W_B CR_09210W_B
TCAAATAACATGCAAAAGTTGTGAAATAGTCAAACCTGTCATGAGGATTTTTAATAGAAC
CTTTTGCTAACATAAGATATTTGTTAACATCATCACTATCACCATAATGCAGTGCACCCC
ACGCTGCTAACAAATTCAGAATAGCTTCATTTGAAAATGCTAAAGTTAGGAAAGTACTTT
TTATATAATTTGTAGATTGACTCAAAGAAAGTGTACTGGCGATTTGTTCAAATTGTCTAA
CATAATCTATACCTTGATCGTCCAAATAAAGTATCAAGGGGGATAATGCATTGGTATTTA
GTATTGGAGAAAATATAGGTTCCGGGAAATGTAAATCTGTGGTTAGTGGGATTAAATCAG
AACATGACACCAGTGGGTTTTTTTGCACTTTCTTGATTCTTTTAGATGGTTTAAATGATG
TTGGATTTAGTATTTTTATTTCGTTATATTCACAAATCAAGTCTCTAGTATGACAAAATG
TGCAAGTGGGGTGAAGTTCATCGCATTTTCTTTTCCTCAAACGACAGTTTTTACATCCTG
TTTTAGATCTCTGTCTTTTAAATCTTGGGGATTGTGAGGACATGAATACTTCTGTTACCA
ATAATAGATTTTGAATCTATAATAATAATGGCGTGTTTGGTTTTAGTAATTTATTTTTGG
CGTGTTTCTTGCTTGCATACATTTGGGCATTAAATCGCCGAAGCAAACAAATATTTTCTT
GGTGTTGTCTCACTTCTTGGTGTAAAAAAAAAAATTACCACGTTAGAGTGGAGTCAGAAG
GAGGAAAAATTCCGGGTCAGGAAAGTCACAAAGCTGTTTAGCCGAAAATAAAAACCACCA
ACATCGAACTTAATCTACTTTTCTCTAAATATTCCTTCTTCTTCTTCTTCTTCTTTCTAT
ATACTGTTGTCTTACCCTCCGAAGTATCTACTGTATTACATTTTTTTTTCATTAGTGACT
AAATCACTTTGCGTTGATTTTAAATGTTCATTAGAAACAA
Chr coordinates Ca22chrRB_C_albicans_SC5314:1961135-1962640W
w3c xhtml validator w3c css validator