PathoYeastract
C.tropicalis
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name CTRG_05931
Strain MYA-3404
Description Protein of unknown function
External source Open in CGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTRG_05931 CTRG_05931
CGAGAAATACCACGTGTGGAGGGATCGATTGTGTAAATGGCTTATTTCTCTTTTTATGTT
TTGTGGAGTAATGTGGGATGATGAATATTCTCTTTAATAATCTTGACCAGATCTTATATC
ATCAGATGATGGATGACTGTATATGCATTTGTAAAAATCAATGAGATATGTTTTGTGCAG
GACCTGCATAAAAATGTCTCGATCTTGCATATAAGATGAGGGGGTTTGGAAGGACGACAT
TCTTACTCTTCTCATTAGACCCCTTCGTTATTGATGACGATAAAGTGGGTAATGTGGGAC
ATATATCAAATAGGAGCACTTGGTCGACGTTACAAAACCTGGAATATAGCAATATATATT
GACTTGATTAACATTTCACACACGCCTTGTGACTTATATCACTGTAAAATGGTAAGCAGC
AAACAAAAAGAGAAACGTACTCAGAGTCACGAAACTAAAAATAGCTCAGATTTCAATCAG
ATCAATTTTAAAGGTCATTTTCAATACTGTGCACACTGACATCATTAAAGTTGCCCTTTT
ATTTGTCTCTACCATGCTCTGCAAGTTACTGTTCCTGCTCCTGTTCCTGTTTCGGCTAGT
GTTACTGATTTTTTTTTCTTTGTCAGCCGGTTGAGGATGTGGGTCAATTTTTTTTGTCTT
ACACGCATCACACACACACACACATACACAGAAAGTTTTTCTTTCGTAAGTTTCCTGACC
TAAACATTGTTTTTAAAAAAGAAAAAAGAAGGAAAAAAAAAACCACAAGATCAAGAATAA
CTCAAGAATATATATATATTATTTCTTTTCTTTGTTGAATCATCGTTGAATTATTATCAA
CTACTATCCATTATAATATTAGAATCATTTACGGATTAACTGTAAAAAAAAAAAATAGTT
AACCTACGGAAAAAATACCTAAGGGGGTTTAAGGAACAGACAAAGTTTAAAAGAAAGTAA
AAGGGGGAAGAAAAAAAAAAAATAAAAGTTAATTGTATAG
Chr coordinates Supercontig_3.10_C_tropicalis_MYA-3404:328562-327045C
w3c xhtml validator w3c css validator