PathoYeastract
C.parapsilosis
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPAR2_700130
Systematic Name CPAR2_700130
Alias CPAG_04224
Strain CDC317
Description Uncharacterized ORF; Ortholog(s) have role in hyphal growth, maltose catabolic process, positive regulation of cell adhesion involved in single-species biofilm formation and regulation of transcription by RNA polymerase II, more
External source Open in CGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CPAR2_700130 CPAR2_700130
AAGGCCATAACCATTTTCTGAGTGGGGACTGAAATGCGAGTAGCTGTTAATTGTATCACT
ATCCAAACGATACAAGTCAACCTCTCCTGATCCATTAATTGTACCTGCTACATTTGGATC
TTGTGGCATGTACCTTGCTCTGCATATCTCTTGATTGTTGGTGTACTTTTGCACAACCTT
GATTCTGGAATTGGCTTTCTGCTCGCCACTTCCAGCAAGCTCGGTTTCAGCAACTTTCAA
ATAGTTTTGGTCATTGCCTGACGTATGTGTACCAAGAAGAAGCTTTGTCTTGATGATTCC
ACTTTCAGTAGTGTGGTTTGGAAGCCATTGTATGGTTAGTGATGGCCATGTCAATGCCGT
TTCACTGACAAACTCATACATGTATCTGCAATTTTTTCTCCATAATTGGTACTCCTCCTT
GATAGATAGCTCTTTTTGCTCTCCATTGTATTCGGTGTCGGACATCTTAAGTTGAATTGA
CTTAGTTAGTAATGGAAGGTGCCTGTCAATCGCGTTTCTTTCGAGTTGGTTGACTTTTTT
GTTTTGTTTCTTTTTTTTTTTTTCGACTCTTTCGTTGAGCTTCTATTAAGAACCCACACG
TCAAAAGCCGGACATGGATGCAAGGGTCTTTCTCGATGAAGCTATTGTAGGTAGCAGCAC
CGTGTCATCTGGATAAGCTCTTTTTCATTTTGTGAGCTCACAAATACGGCTCTCACTGAA
CAATGTATCTCTGGCGAAGAACTTTTTTCGTAAAGCTAGATCTGTTGTCATACCAGTTTA
CTTATTGTTCCTCCCCCCCTCAGTTCATATCACAAGAAGTCTGTGGCGGGTTCTACTGCC
GTCGTGCTCCCTATTGGTATAACGTGTGTGGATCGCTTCGCCGGTATCGCTTTAAATAGA
AACCCTGAGCATAAAGGGAAAAACAGAAAAAATAATAACAATCTCGGAGAAAAACTTTAA
ATATATTCTCCTCACCATTTACGAGATGGAATCAAGCCAC
Chr coordinates Contig006110_C_parapsilosis_CDC317:31799-30084C
w3c xhtml validator w3c css validator