PathoYeastract
C.parapsilosis
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPAR2_700130
Systematic Name CPAR2_700130
Alias CPAG_04224
Strain CDC317
Description Uncharacterized ORF; Ortholog(s) have role in hyphal growth, maltose catabolic process, positive regulation of cell adhesion involved in single-species biofilm formation and regulation of transcription by RNA polymerase II, more
External source Open in CGD external link
Gene Sequence
Download FASTA
Hide Seq
>CPAR2_700130 CPAR2_700130
ATGAACTCTAATTATAACTATACAGAGACGGTGGCGTATCATAGCGTTTCAGAAGACTCC
CCTGCCAGAACCGCCTCTGACCACAATCCAAACTCGGTGTCCTCATTTGAGTCACAGCTA
GGCTTTTCCCCTGACGGATATATAAACTCCATTAATGACGAGATCTACGCTGCACAATTA
AATCCAATCTTAGGTGAAACCCGCGTGAATAACTTTGACGTGGGATCCTCGAATGGAGTG
ATGGAATCTGCGATGAGTCCCTCGAAGCAAACTGTGGATGCTGTCGAGATGGCAGGTTCG
AGCCATGAAGTGGAGAATGCTGTGGCTCAGTCTGTTCGCAAAAGCAAAAGAGCGTGCGAT
TCGTGCAGTATCAGGAAGGTAAAGTGTGACTTAAAAGTACCATGCAGTCGATGTGTAACT
CATGGATTGGAGTGTACAAATATCAGGGTAAAGAAAAAGTGTGGCCCGAAAAAGATTCAC
GACAAGACAAGAGATGCAATTAAGAAGTTGGCTATAACTAGTGCTTTGGAAAGCAATCTG
TTTGTTCCCATAATTGGCATGGATAAGCTTTTATCTTGCCTCAATGTTTACCAGGTGTGG
TACTATGGAATTTGGCCTGTTATATCAGTCGCGGAATTGATTTCACGAGCAGTTGAACCA
CCTGCATATGCCTTGAGTTGTGCTGTGTGTGCAACAATTGCGAGCCAGGTGAGGTTCATG
ACCAATCAAAAGCTTGTCCCCAAGAGCATACTTGACATTGATTTTGCATCAGAAGCAATT
CGAGTCAAGAAAACAGAACCGACACTAGAGAGTATTTTGACATCGTTCTTTCTCCATATC
GCATTAGCTAACGCAGGGGCTGGTCCTACTGCTTTATGTTATTTGAGGGAGGCAATAACA
CTCGCACAAATCCTCGGTCTTGATAGGGTGGATACATATTCAAGATCACCAGCCGAAACC
CATCGAATGAGAAAGATCTACTACCTCTTGGTGGTCACTGAACGATTTGTATGTTTAGAG
CAATCTTTGCCGGTGATCCTTGAACCAACGGTGCCGTTTCCTTCACTTGATGATGAAGAA
TACTCAATTTTGATAGGTGGGTTTAGAGAATTGGTCAAGATATTTGCAATTCCAAACAAG
TCTATTTTTGATCAATTTAGAGCGATCAAAAATGATGCACACTCATTACGTTTGATCTCG
ACCGTGCAGAATCAGTTACAGCAAATTACTATACTAGATGCAGCACCGGATATTCAAAAG
GCGAATATATTATTGAGCAAGTATTGGATGATGACCTTAACATGGGACGTTGCCATTGCA
AACAACATGATTAACAATCTGGAGTTTTGCTTGACTAATGAGTTCCCGATAGCAATTGCT
AAAGAATTTTGCGAAAGAACTGTTGGGTTGCCCCTTGTTTCATATGAGTTCAATGGGCCT
GGTGTTTGCCTCAAGCTAGAGGTCATTGCAAAAGCTTTAATGAAGGCTGTCAATATAACA
AGAGATTCGAGGGGTTATGAGTATGTGCGGCGCATCTTTGAATTGTTAACGTTATTGAGA
AATGAAGTACGGCTCGCAATGGACCAATTTCATATGCTTGAAGCTACATTGACTGAGATG
GAAGCGATGTTGAGATTCAAAGGAGCAAAAGTTGGGTACATAACGAATATTGATACGTTC
GATGGTGTTATCGGTCTGAATGTATACGAAAATTGA
Promoter Sequence
Download FASTA
>CPAR2_700130 CPAR2_700130
AAGGCCATAACCATTTTCTGAGTGGGGACTGAAATGCGAGTAGCTGTTAATTGTATCACT
ATCCAAACGATACAAGTCAACCTCTCCTGATCCATTAATTGTACCTGCTACATTTGGATC
TTGTGGCATGTACCTTGCTCTGCATATCTCTTGATTGTTGGTGTACTTTTGCACAACCTT
GATTCTGGAATTGGCTTTCTGCTCGCCACTTCCAGCAAGCTCGGTTTCAGCAACTTTCAA
ATAGTTTTGGTCATTGCCTGACGTATGTGTACCAAGAAGAAGCTTTGTCTTGATGATTCC
ACTTTCAGTAGTGTGGTTTGGAAGCCATTGTATGGTTAGTGATGGCCATGTCAATGCCGT
TTCACTGACAAACTCATACATGTATCTGCAATTTTTTCTCCATAATTGGTACTCCTCCTT
GATAGATAGCTCTTTTTGCTCTCCATTGTATTCGGTGTCGGACATCTTAAGTTGAATTGA
CTTAGTTAGTAATGGAAGGTGCCTGTCAATCGCGTTTCTTTCGAGTTGGTTGACTTTTTT
GTTTTGTTTCTTTTTTTTTTTTTCGACTCTTTCGTTGAGCTTCTATTAAGAACCCACACG
TCAAAAGCCGGACATGGATGCAAGGGTCTTTCTCGATGAAGCTATTGTAGGTAGCAGCAC
CGTGTCATCTGGATAAGCTCTTTTTCATTTTGTGAGCTCACAAATACGGCTCTCACTGAA
CAATGTATCTCTGGCGAAGAACTTTTTTCGTAAAGCTAGATCTGTTGTCATACCAGTTTA
CTTATTGTTCCTCCCCCCCTCAGTTCATATCACAAGAAGTCTGTGGCGGGTTCTACTGCC
GTCGTGCTCCCTATTGGTATAACGTGTGTGGATCGCTTCGCCGGTATCGCTTTAAATAGA
AACCCTGAGCATAAAGGGAAAAACAGAAAAAATAATAACAATCTCGGAGAAAAACTTTAA
ATATATTCTCCTCACCATTTACGAGATGGAATCAAGCCAC
Chr coordinates Contig006110_C_parapsilosis_CDC317:31799-30084C
w3c xhtml validator w3c css validator